Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Rhodococcus opacus B4

Properties
Regulator type: Transcription factor
TF locus tag: ROP_29950, ROP_00150
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Regulog: ArsR - Nocardiaceae
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -13
Score: 7.1
Sequence: TCAATATCGACGCATGTCGA
Locus tag: ROP_29950
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: ROP_29960
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_29970
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR
Arsenical resistance operon repressor, ArsR family
arsB
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)

Position: -13
Score: 7.2
Sequence: TCAATATCGACGTATGTCGA
Locus tag: ROP_00150
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: ROP_00160
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00170
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00180
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00190
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: ROP_00200
Name: arsD
Funciton: Arsenical resistance operon trans-acting repressor arsD
Locus tag: ROP_00210
Name: arsA
Funciton: Arsenical pump-driving ATPase (EC 3.6.3.16)
arsR
Arsenical resistance operon repressor, ArsR family
arsB
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
arsD
Arsenical resistance operon trans-acting repressor arsD
arsA
Arsenical pump-driving ATPase (EC 3.6.3.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD