Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Rhodococcus erythropolis PR4

Properties
Regulator type: Transcription factor
TF locus tag: pREL1_0158, RER_35210
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Regulog: ArsR - Nocardiaceae
Statistics of regulated genes:
- Genes 11
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -28
Score: 6.9
Sequence: TCAATATTGATGTATGTCGA
Locus tag: pREL1_0158
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: pREL1_0159
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pREL1_0160
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pREL1_0161
Name: trxB
Funciton: Thioredoxin reductase (EC 1.8.1.9)
Locus tag: pREL1_0162
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pREL1_0163
Name: pREL1_0163
Funciton: Monooxygenase, putative
Locus tag: pREL1_0164
Name: arsD
Funciton: Arsenical resistance operon trans-acting repressor arsD
Locus tag: pREL1_0165
Name: arsA
Funciton: Arsenical pump-driving ATPase (EC 3.6.3.16)
arsR
Arsenical resistance operon repressor, ArsR family
arsB
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
trxB
Thioredoxin reductase (EC 1.8.1.9)
arsC
Arsenate reductase (EC 1.20.4.1)
pREL1_0163
Monooxygenase, putative
arsD
Arsenical resistance operon trans-acting repressor arsD
arsA
Arsenical pump-driving ATPase (EC 3.6.3.16)

Position: -13
Score: 6.9
Sequence: TCAATATCGAAGAATGTCGA
Locus tag: RER_35210
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: RER_35200
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: RER_35190
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR
Arsenical resistance operon repressor, ArsR family
arsB
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD