Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArsR in Nocardia farcinica IFM 10152

Properties
Regulator type: Transcription factor
TF locus tag: pnf2240, nfa24490
Regulator family: ArsR
Regulation mode: repressor
Biological process: Arsenic resistance
Effector: Arsenite; Arsenate
Regulog: ArsR - Nocardiaceae
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -13
Score: 6.8
Sequence: TCAATATTGGCGTATGTCGA
Locus tag: pnf2240
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: pnf2250
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pnf2260
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pnf2270
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: pnf2280
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR
Arsenical resistance operon repressor, ArsR family
arsB
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)

Position: -13
Score: 6.5
Sequence: TCAATATCGATGCATGTCTA
Locus tag: nfa24490
Name: arsR
Funciton: Arsenical resistance operon repressor, ArsR family
Locus tag: nfa24500
Name: arsB
Funciton: Arsenate reductase (EC 1.20.4.1)
Locus tag: nfa24510
Name: arsC
Funciton: Arsenate reductase (EC 1.20.4.1)
arsR
Arsenical resistance operon repressor, ArsR family
arsB
Arsenate reductase (EC 1.20.4.1)
arsC
Arsenate reductase (EC 1.20.4.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD