Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SdaR in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type: Transcription factor
TF locus tag: VIBHAR_06864
Regulator family: SdaR
Regulation mode: activator
Biological process: Glycerate utilization
Effector: D-glycerate
Regulog: SdaR - Vibrionales
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -144
Score: 6.5
Sequence: AATTGTGCAAGTGCACAAAA
Locus tag: VIBHAR_06863
Name: garK
Funciton: Glycerate kinase (EC 2.7.1.31)
garK
Glycerate kinase (EC 2.7.1.31)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD