Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GudR in Polaromonas naphthalenivorans CJ2

Properties
Regulator type: Transcription factor
TF locus tag: Pnap_1131
Regulator family: LacI
Regulation mode:
Biological process: Glucarate utilization
Effector:
Regulog: GudR - Comamonadaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -93
Score: 5.7
Sequence: AAATGTTACCGATAACATTG
Locus tag: Pnap_1130
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
gudD
Glucarate dehydratase (EC 4.2.1.40)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD