Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GudR in Polaromonas sp. JS666

Properties
Regulator type: Transcription factor
TF locus tag: Bpro_3418, Bpro_4527
Regulator family: LacI
Regulation mode:
Biological process: Glucarate utilization
Effector:
Regulog: GudR - Comamonadaceae
Statistics of regulated genes:
- Genes 7
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -29
Score: 6
Sequence: AAAAGGTAGCGCTACCATTC
Position: -2
Score: 5.5
Sequence: CAATGGTAGCGCTACCTTTA
Locus tag: Bpro_3419
Name: kdgD
Funciton: 5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
Locus tag: Bpro_3420
Name: tctC4
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
Locus tag: Bpro_3421
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
Locus tag: Bpro_3422
Name: kgsD
Funciton: Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)
kdgD
5-dehydro-4-deoxyglucarate dehydratase (EC 4.2.1.41)
tctC4
Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
gudD
Glucarate dehydratase (EC 4.2.1.40)
kgsD
Alpha-ketoglutaric semialdehyde dehydrogenase (EC 1.2.1.26)

Position: -79
Score: 5.9
Sequence: AATTGTTAGCGCTAACATTC
Locus tag: Bpro_4526
Name: tctC
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
tctC
Tripartite tricarboxylate transporter family receptor, putative transporter for uronates

Position: -33
Score: 5.2
Sequence: GACTGGTAGCGCTATCGTCG
Locus tag: Bpro_3418
Name: gudR
Funciton: Predicted D-glucarate utilization regulator, LacI family
gudR
Predicted D-glucarate utilization regulator, LacI family

Position: -24
Score: 4.9
Sequence: GCAAGTTAGCGTTAACATCA
Locus tag: Bpro_4527
Name: gudR
Funciton: Predicted D-glucarate utilization regulator, LacI family
gudR
Predicted D-glucarate utilization regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD