Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GudR in Methylibium petroleiphilum PM1

Properties
Regulator type: Transcription factor
TF locus tag: Mpe_A0968
Regulator family: LacI
Regulation mode:
Biological process: Glucarate utilization
Effector:
Regulog: GudR - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 11 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -73
Score: 6
Sequence: GAACGGTAGCGCTACCATTT
Position: -51
Score: 4.8
Sequence: AGACGATAGCGCTACCAGAT
Locus tag: Mpe_A0969
Name: tctC4
Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
Locus tag: Mpe_A0970
Name: gudD
Funciton: Glucarate dehydratase (EC 4.2.1.40)
tctC4
Tripartite tricarboxylate transporter family receptor, putative transporter for uronates
gudD
Glucarate dehydratase (EC 4.2.1.40)

Position: -36
Score: 5.5
Sequence: GGATGGTAGCGGTGTCATCT
Locus tag: Mpe_A0968
Name: gudR
Funciton: Predicted D-glucarate utilization regulator, LacI family
gudR
Predicted D-glucarate utilization regulator, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD