Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of QorR in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_37581
Regulator family: HxlR
Regulation mode: repressor
Biological process: Energy metabolism
Effector:
Regulog: QorR - Streptomycetaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -68
Score: 5.9
Sequence: GTACTTTCGCAGAGTTAGCGC
Locus tag: SCAB_37591
Name: qorD
Funciton: NADPH:quinone oxidoreductase 2, possible protective/detoxification role
Locus tag: SCAB_37601
Name: qorB
Funciton: Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)
qorD
NADPH:quinone oxidoreductase 2, possible protective/detoxification role
qorB
Quinone oxidoreductase 2, NAD(P)H dependent (EC 1.6.5.2)

Position: -44
Score: 5.9
Sequence: GCGCTAACTCTGCGAAAGTAC
Locus tag: SCAB_37581
Name: qorR
Funciton: Redox-sensing transcriptional regulator QorR, HxlR family
qorR
Redox-sensing transcriptional regulator QorR, HxlR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD