Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Saccharopolyspora erythraea NRRL 2338

Properties
Regulator type: Transcription factor
TF locus tag: SACE_3541
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -186
Score: 5.5
Sequence: ACTGACCGAGTAGTCGGTTATT
Position: -52
Score: 5.5
Sequence: CGTTACCGAACGAACGGTCGGT
Position: -48
Score: 5.4
Sequence: ACCGAACGAACGGTCGGTAAAA
Locus tag: SACE_3543
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
Locus tag: SACE_3544
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: SACE_3545
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: SACE_3546
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: SACE_3547
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: SACE_3548
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
paaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)

Position: -232
Score: 5.4
Sequence: TTTTACCGACCGTTCGTTCGGT
Position: -228
Score: 5.5
Sequence: ACCGACCGTTCGTTCGGTAACG
Position: -94
Score: 5.5
Sequence: AATAACCGACTACTCGGTCAGT
Locus tag: SACE_3542
Name: paaK
Funciton: Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
Locus tag: SACE_3541
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
paaK
Phenylacetate-coenzyme A ligase (EC 6.2.1.30)
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD