Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PaaR in Nakamurella multipartita DSM 44233

Properties
Regulator type: Transcription factor
TF locus tag: Namu_2483
Regulator family: TetR
Regulation mode: repressor
Biological process: Phenylacetic acid degradation
Effector: Phenylacetyl-CoA
Regulog: PaaR - Frankineae/Propionibacterineae/Pseudonocardiaceae
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 14 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -70
Score: 5.6
Sequence: TCTTACTGACCGTTCGGTCAGT
Position: -66
Score: 5
Sequence: ACTGACCGTTCGGTCAGTTACA
Locus tag: Namu_2491
Name: paaA
Funciton: Phenylacetate-CoA oxygenase, PaaA subunit
Locus tag: Namu_2490
Name: paaB
Funciton: Phenylacetate-CoA oxygenase, PaaB subunit
Locus tag: Namu_2489
Name: paaC
Funciton: Phenylacetate-CoA oxygenase, PaaC subunit
Locus tag: Namu_2488
Name: paaD
Funciton: Phenylacetate-CoA oxygenase, PaaD subunit
Locus tag: Namu_2487
Name: paaE
Funciton: Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
Locus tag: Namu_2486
Name: null
Funciton: hypothetical protein
Locus tag: Namu_2485
Name: paaZ
Funciton: Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ
paaA
Phenylacetate-CoA oxygenase, PaaA subunit
paaB
Phenylacetate-CoA oxygenase, PaaB subunit
paaC
Phenylacetate-CoA oxygenase, PaaC subunit
paaD
Phenylacetate-CoA oxygenase, PaaD subunit
paaE
Probable phenylacetic acid degradation NADH oxidoreductase paaE (EC 1.-.-.-)
hypothetical protein
paaZ
Aldehyde dehydrogenase (EC 1.2.1.3), PaaZ

Position: -43
Score: 6
Sequence: ACTGACCGAATGATCGGTCAGC
Locus tag: Namu_2483
Name: paaR
Funciton: Transcriptional regulator of phenylacetic acid degradation, TetR family
Locus tag: Namu_2482
Name: paaH
Funciton: 3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
Locus tag: Namu_2481
Name: paaI
Funciton: Phenylacetic acid degradation protein PaaI, thioesterase
paaR
Transcriptional regulator of phenylacetic acid degradation, TetR family
paaH
3-hydroxybutyryl-CoA dehydrogenase (EC 1.1.1.157)
paaI
Phenylacetic acid degradation protein PaaI, thioesterase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD