Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SamR in Xylella fastidiosa 9a5c

Properties
Regulator type: Transcription factor
TF locus tag: XF1617
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylmethionine
Regulog: SamR - Xanthomonadales
Statistics of regulated genes:
- Genes 6
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -249
Score: 6.7
Sequence: ATCTTTCTATCCGTATGGAGAGAT
Locus tag: XF0863
Name: metX2
Funciton: Homoserine O-acetyltransferase (EC 2.3.1.31)
Locus tag: XF0864
Name: metB
Funciton: Cystathionine gamma-synthase (EC 2.5.1.48)
metX2
Homoserine O-acetyltransferase (EC 2.3.1.31)
metB
Cystathionine gamma-synthase (EC 2.5.1.48)

Position: -408
Score: 5.7
Sequence: ATCGCTATATCTGGATGAAGCGAT
Locus tag: XF2272
Name: metE
Funciton: 5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)
metE
5-methyltetrahydropteroyltriglutamate--homocysteine methyltransferase (EC 2.1.1.14)

Position: -55
Score: 5
Sequence: TCACATTCATCCGGATGAAGAGAT
Locus tag: XF1121
Name: metF2
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF2
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Position: -33
Score: 6.5
Sequence: ATCTTTTCATTCGAATTAAGGGAT
Locus tag: XF0392
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
metK
S-adenosylmethionine synthetase (EC 2.5.1.6)

Position: -28
Score: 5.8
Sequence: ATCTCTGTATCGAGATATAGACAT
Locus tag: XF1617
Name: samR
Funciton: Transcriptional regulator of methionine metabolism, ArsR family
samR
Transcriptional regulator of methionine metabolism, ArsR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD