Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SamR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type: Transcription factor
TF locus tag: XAC1561
Regulator family: ArsR
Regulation mode: repressor
Biological process: Methionine metabolism
Effector: S-adenosylmethionine
Regulog: SamR - Xanthomonadales
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 17 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -57
Score: 5.5
Sequence: ATGCATTCATCGCGATGAAGCGAT
Locus tag: XAC0791
Name: metF2
Funciton: 5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)
metF2
5,10-methylenetetrahydrofolate reductase (EC 1.5.1.20)

Position: -28
Score: 6.3
Sequence: ATCTCCATATCGCGATATAGAGAT
Locus tag: XAC1561
Name: samR
Funciton: Transcriptional regulator of methionine metabolism, ArsR family
Locus tag: XAC1560
Name: metH2
Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
Locus tag: XAC1559
Name: metH1
Funciton: 5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
samR
Transcriptional regulator of methionine metabolism, ArsR family
metH2
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)
metH1
5-methyltetrahydrofolate--homocysteine methyltransferase (EC 2.1.1.13)

Position: -33
Score: 6.7
Sequence: ATCTTTTCATCCGAATTAAGGGAT
Locus tag: XAC0813
Name: metK
Funciton: S-adenosylmethionine synthetase (EC 2.5.1.6)
metK
S-adenosylmethionine synthetase (EC 2.5.1.6)

Position: -247
Score: 6.8
Sequence: ATCTTTCCATCCGCATGAAGAGAT
Locus tag: XAC3040
Name: metX2
Funciton: Homoserine O-acetyltransferase (EC 2.3.1.31)
Locus tag: XAC3039
Name: metB
Funciton: Cystathionine gamma-synthase (EC 2.5.1.48)
Locus tag: XAC3038
Name: hom
Funciton: Homoserine dehydrogenase (EC 1.1.1.3)
metX2
Homoserine O-acetyltransferase (EC 2.3.1.31)
metB
Cystathionine gamma-synthase (EC 2.5.1.48)
hom
Homoserine dehydrogenase (EC 1.1.1.3)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD