Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SdhR in Acidovorax sp. JS42

Properties
Regulator type: Transcription factor
TF locus tag: Ajs_2792
Regulator family: GntR/Others
Regulation mode:
Biological process: Tricarboxylic acid cycle
Effector:
Regulog: SdhR - Comamonadaceae
Statistics of regulated genes:
- Genes 13
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 36 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -4
Score: 7.2
Sequence: TCTTATGTCTTATATAAGATATGATC
Locus tag: Ajs_2792
Name: sdhR
Funciton: Transcriptional regulator of TCA cycle, GntR family
Locus tag: Ajs_2793
Name: sdhC
Funciton: Succinate dehydrogenase cytochrome b-556 subunit
Locus tag: Ajs_2794
Name: sdhD
Funciton: Succinate dehydrogenase hydrophobic membrane anchor protein
Locus tag: Ajs_2795
Name: sdhA
Funciton: Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
Locus tag: Ajs_2796
Name: sdhB
Funciton: Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
Locus tag: Ajs_2797
Name: COG2938
Funciton: succinate dehydrogenase iron-sulfur subunit
Locus tag: Ajs_2798
Name: gltA
Funciton: Citrate synthase (si) (EC 2.3.3.1)
sdhR
Transcriptional regulator of TCA cycle, GntR family
sdhC
Succinate dehydrogenase cytochrome b-556 subunit
sdhD
Succinate dehydrogenase hydrophobic membrane anchor protein
sdhA
Succinate dehydrogenase flavoprotein subunit (EC 1.3.99.1)
sdhB
Succinate dehydrogenase iron-sulfur protein (EC 1.3.99.1)
COG2938
succinate dehydrogenase iron-sulfur subunit
gltA
Citrate synthase (si) (EC 2.3.3.1)

Position: -91
Score: 7.2
Sequence: GATCATATCTTATATAAGACATAAGA
Locus tag: Ajs_2791
Name: mdh
Funciton: Malate dehydrogenase (EC 1.1.1.37)
Locus tag: Ajs_2790
Name: tam
Funciton: Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
Locus tag: Ajs_2789
Name: citE
Funciton: Citrate lyase beta chain (EC 4.1.3.6)
Locus tag: Ajs_2788
Name: Aave_2209
Funciton: hypothetical protein
Locus tag: Ajs_2787
Name: acnB
Funciton: Aconitate hydratase (EC 4.2.1.3)
mdh
Malate dehydrogenase (EC 1.1.1.37)
tam
Trans-aconitate 2-methyltransferase (EC 2.1.1.144)
citE
Citrate lyase beta chain (EC 4.1.3.6)
Aave_2209
hypothetical protein
acnB
Aconitate hydratase (EC 4.2.1.3)

Position: -115
Score: 6.9
Sequence: ATTTATCTCTTATATAAGACATAAGA
Locus tag: Ajs_2401
Name: aceA
Funciton: Isocitrate lyase (EC 4.1.3.1)
aceA
Isocitrate lyase (EC 4.1.3.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD