Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HisR in Xanthomonas campestris pv. campestris str. ATCC 33913

Properties
Regulator type: Transcription factor
TF locus tag: XCC1807
Regulator family: TrpR
Regulation mode: repressor
Biological process: Histidine biosynthesis
Effector: Histidine
Regulog: HisR - Xanthomonadales
Statistics of regulated genes:
- Genes 9
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -28
Score: 7.3
Sequence: TGTACTAACACGCTATTACA
Locus tag: XCC1807
Name: hisR
Funciton: Predicted histidine repressor, TrpR family
hisR
Predicted histidine repressor, TrpR family

Position: -364
Score: 7.3
Sequence: TGTACTAACACGCTATTACA
Locus tag: XCC1808
Name: hisG
Funciton: ATP phosphoribosyltransferase (EC 2.4.2.17)
Locus tag: XCC1809
Name: hisD
Funciton: Histidinol dehydrogenase (EC 1.1.1.23)
Locus tag: XCC1810
Name: hisC
Funciton: Histidinol-phosphate aminotransferase (EC 2.6.1.9)
Locus tag: XCC1811
Name: hisB
Funciton: Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
Locus tag: XCC1812
Name: hisH
Funciton: Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
Locus tag: XCC1813
Name: hisA
Funciton: Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
Locus tag: XCC1814
Name: hisF
Funciton: Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
Locus tag: XCC1815
Name: hisIE
Funciton: Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
hisG
ATP phosphoribosyltransferase (EC 2.4.2.17)
hisD
Histidinol dehydrogenase (EC 1.1.1.23)
hisC
Histidinol-phosphate aminotransferase (EC 2.6.1.9)
hisB
Histidinol-phosphatase (EC 3.1.3.15) / Imidazoleglycerol-phosphate dehydratase (EC 4.2.1.19)
hisH
Imidazole glycerol phosphate synthase amidotransferase subunit (EC 2.4.2.-)
hisA
Phosphoribosylformimino-5-aminoimidazole carboxamide ribotide isomerase (EC 5.3.1.16)
hisF
Imidazole glycerol phosphate synthase cyclase subunit (EC 4.1.3.-)
hisIE
Phosphoribosyl-AMP cyclohydrolase (EC 3.5.4.19) / Phosphoribosyl-ATP pyrophosphatase (EC 3.6.1.31)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD