Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TyrR in Vibrio splendidus LGP32

Properties
Regulator type: Transcription factor
TF locus tag: VS_1793
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Vibrionales
Statistics of regulated genes:
- Genes 13
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -163
Score: 5.1
Sequence: CTGTACATATTAATATACAG
Position: -144
Score: 4.5
Sequence: GTGGATATTTTTAATTACAT
Locus tag: VS_II0802
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP
tyrosine-specific transport protein

Position: -135
Score: 6.2
Sequence: GTGTAAACTTAAATTTACAC
Position: -28
Score: 6
Sequence: GTGTAAAAATAAATATACAG
Locus tag: VS_0547
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Locus tag: VS_0548
Name: tyrA
Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
aroF
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)

Position: -112
Score: 5.6
Sequence: GTGTAACATTTTATTTACAC
Locus tag: VS_II1510
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA
Acetoacetyl-CoA synthetase (EC 6.2.1.16)

Position: -107
Score: 6.5
Sequence: GTGTAAATAAAATGTTACAC
Locus tag: VS_II1509
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: VS_II1508
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhA
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)

Position: -146
Score: 5.4
Sequence: GTGTAACAAATATTTTACAA
Locus tag: VS_II1521
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VS_II1520
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VS_II1519
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VS_II1518
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hmgA
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
Maleylacetoacetate isomerase (EC 5.2.1.2)

Position: -87
Score: 5.9
Sequence: GTGTAAATTATTATATACAC
Locus tag: VS_1980
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family

Position: -190
Score: 5.1
Sequence: GTGTAAATAATGTTATACGG
Locus tag: VS_II0387
Name: aroG
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)
aroG
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase I alpha (EC 2.5.1.54)

Position: -93
Score: 4.9
Sequence: GAGTAAACATATGTTTACTC
Locus tag: VS_1793
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR
Transcriptional regulator of aromatic amino acid biosynthesis
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD