Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TyrR in Vibrio shilonii AK1

Properties
Regulator type: Transcription factor
TF locus tag: VSAK1_01477
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Vibrionales
Statistics of regulated genes:
- Genes 13
- Operons 8
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -165
Score: 5.1
Sequence: CTGTAAACACACTTTTACAC
Position: -144
Score: 4.6
Sequence: AGATAAATTTATGTTTACAT
Locus tag: VSAK1_15307
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP
tyrosine-specific transport protein

Position: -136
Score: 5.2
Sequence: GTGTATAAAAATAAATACAC
Locus tag: VSAK1_16422
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family

Position: -111
Score: 5.1
Sequence: GTGTAAAATTTGAATTACAT
Locus tag: VSAK1_10508
Name: COG1284
Funciton: Conserved hypothetical protein
COG1284
Conserved hypothetical protein

Position: -169
Score: 4.8
Sequence: ATGTAGCAAAAATGTTACAA
Locus tag: VSAK1_19029
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VSAK1_19034
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VSAK1_19039
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VSAK1_19044
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hmgA
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
Maleylacetoacetate isomerase (EC 5.2.1.2)

Position: -136
Score: 5.5
Sequence: GTGTAACAATTTATTTACAT
Locus tag: VSAK1_21594
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA
Acetoacetyl-CoA synthetase (EC 6.2.1.16)

Position: -109
Score: 6.3
Sequence: ATGTAAATAAATTGTTACAC
Locus tag: VSAK1_21599
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: VSAK1_21604
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhA
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)

Position: -141
Score: 6
Sequence: GTGTAAAATTATATTTACAT
Position: -28
Score: 6.4
Sequence: GTGTAAAATAATATTTACAG
Locus tag: VSAK1_14082
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Locus tag: VSAK1_14087
Name: tyrA
Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
aroF
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)

Position: -154
Score: 5.9
Sequence: GTGTAAACTAAAGATTACAC
Locus tag: VSAK1_01272
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD