Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TyrR in Vibrio salmonicida LFI1238

Properties
Regulator type: Transcription factor
TF locus tag: VSAL_II0864
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Vibrionales
Statistics of regulated genes:
- Genes 5
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -137
Score: 5.1
Sequence: TTGTAAATTTAAGTTTACGA
Position: -28
Score: 5.2
Sequence: ATGGACATAAAAGTTTACAG
Locus tag: VSAL_I0653
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Locus tag: VSAL_I0654
Name: tyrA
Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
aroF
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)

Position: -117
Score: 5.3
Sequence: TTGTAATAATAAGTTTACAC
Locus tag: VSAL_I1774
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP
tyrosine-specific transport protein

Position: -41
Score: 5.2
Sequence: CTGTAAACATATTGTGACAC
Locus tag: VSAL_II0864
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR
Transcriptional regulator of aromatic amino acid biosynthesis

Position: -52
Score: 5.6
Sequence: ATGTAAAATATAATTTACAA
Locus tag: VSAL_I1935
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD