Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TyrR in Vibrio harveyi ATCC BAA-1116

Properties
Regulator type: Transcription factor
TF locus tag: VIBHAR_01919
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Vibrionales
Statistics of regulated genes:
- Genes 11
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -136
Score: 5.9
Sequence: GTGTACATTAATATTTACAC
Locus tag: VIBHAR_02692
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family

Position: -139
Score: 6.4
Sequence: ATGTAAATTAAAATTTACAC
Position: -29
Score: 6
Sequence: GTGTAAACATAAATATACAG
Locus tag: VIBHAR_00992
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Locus tag: VIBHAR_00993
Name: tyrA
Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
aroF
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)

Position: -287
Score: 5.5
Sequence: GTGTATAAAATAGTTTACAC
Position: -139
Score: 5.2
Sequence: CTGTAAAGATAAATATACAA
Locus tag: VIBHAR_02530
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP
tyrosine-specific transport protein

Position: -130
Score: 4.9
Sequence: GTGTAACATTTTCTTTACAT
Locus tag: VIBHAR_05420
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
acsA
Acetoacetyl-CoA synthetase (EC 6.2.1.16)

Position: -111
Score: 6.1
Sequence: ATGTAAAGAAAATGTTACAC
Locus tag: VIBHAR_05421
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: VIBHAR_05422
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhA
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)

Position: -147
Score: 5.2
Sequence: CTGTAACATAAATTTTACAA
Locus tag: VIBHAR_02177
Name: hpd
Funciton: 4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
Locus tag: VIBHAR_02178
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VIBHAR_02179
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VIBHAR_02180
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
hpd
4-hydroxyphenylpyruvate dioxygenase (EC 1.13.11.27)
hmgA
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
Maleylacetoacetate isomerase (EC 5.2.1.2)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD