Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of TyrR in Vibrio angustum S14

Properties
Regulator type: Transcription factor
TF locus tag: VAS14_00826
Regulator family: TyrR
Regulation mode: activator (repressor)
Biological process: Aromatic amino acid metabolism
Effector: Tyrosine; Phenylalanine
Regulog: TyrR - Vibrionales
Statistics of regulated genes:
- Genes 12
- Operons 7
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 83 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -106
Score: 6
Sequence: GTGTAAAAAATATATTACAG
Locus tag: VAS14_16576
Name: COG1284
Funciton: Conserved hypothetical protein
COG1284
Conserved hypothetical protein

Position: -161
Score: 6.1
Sequence: CTGTAAATAATTATTTACAG
Locus tag: VAS14_20611
Name: aroF
Funciton: 2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
Locus tag: VAS14_20616
Name: tyrA
Funciton: Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)
aroF
2-keto-3-deoxy-D-arabino-heptulosonate-7-phosphate synthase (EC 2.5.1.54)
tyrA
Chorismate mutase I (EC 5.4.99.5) / Cyclohexadienyl dehydrogenase (EC 1.3.1.12)(EC 1.3.1.43)

Position: -312
Score: 5.6
Sequence: ACGTAAATATAAATTTACAT
Position: -125
Score: 5.9
Sequence: ATGTAACTAAAAGTTTACAC
Locus tag: VAS14_18444
Name: tyrP
Funciton: tyrosine-specific transport protein
tyrP
tyrosine-specific transport protein

Position: -182
Score: 3.8
Sequence: ATGTTCATTCTTGTTTACAA
Locus tag: VAS14_11219
Name: phhA
Funciton: Phenylalanine-4-hydroxylase (EC 1.14.16.1)
Locus tag: VAS14_11224
Name: phhB
Funciton: Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)
phhA
Phenylalanine-4-hydroxylase (EC 1.14.16.1)
phhB
Pterin-4-alpha-carbinolamine dehydratase (EC 4.2.1.96)

Position: -243
Score: 4.8
Sequence: GTGTAAACCTTAAATAACAC
Locus tag: VAS14_13304
Name: COG0733
Funciton: Predicted 4-Hydroxyphenylpyruvate transporter, SNF family
COG0733
Predicted 4-Hydroxyphenylpyruvate transporter, SNF family

Position: -109
Score: 4.2
Sequence: TTGTAAACAAGAATGAACAT
Locus tag: VAS14_11214
Name: hmgA
Funciton: Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
Locus tag: VAS14_11209
Name: hmgC
Funciton: Fumarylacetoacetase (EC 3.7.1.2)
Locus tag: VAS14_11204
Name: hmgB
Funciton: Maleylacetoacetate isomerase (EC 5.2.1.2)
Locus tag: VAS14_11199
Name: acsA
Funciton: Acetoacetyl-CoA synthetase (EC 6.2.1.16)
hmgA
Homogentisate 1,2-dioxygenase (EC 1.13.11.5)
hmgC
Fumarylacetoacetase (EC 3.7.1.2)
hmgB
Maleylacetoacetate isomerase (EC 5.2.1.2)
acsA
Acetoacetyl-CoA synthetase (EC 6.2.1.16)

Position: -147
Score: 4.6
Sequence: GTGTAAACTCATATTAATAC
Locus tag: VAS14_00826
Name: tyrR
Funciton: Transcriptional regulator of aromatic amino acid biosynthesis
tyrR
Transcriptional regulator of aromatic amino acid biosynthesis
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD