Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArgR in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO1576
Regulator family: ArgR
Regulation mode: repressor (activator)
Biological process: Arginine biosynthesis
Effector: Arginine
Regulog: ArgR - Streptomycetaceae
Statistics of regulated genes:
- Genes 10
- Operons 6
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 29 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -37
Score: 5.3
Sequence: CTTTGCATGGTCATGCGTAA
Position: -27
Score: 4.3
Sequence: TCATGCGTAATGATGCATAC
Locus tag: SCO7036
Name: argG
Funciton: Argininosuccinate synthase (EC 6.3.4.5)
argG
Argininosuccinate synthase (EC 6.3.4.5)

Position: -59
Score: 3.9
Sequence: ACATGCAGAGTTCTGCATAC
Position: -49
Score: 5.3
Sequence: TTCTGCATACTCATGCATGA
Locus tag: SCO1570
Name: argH
Funciton: Argininosuccinate lyase (EC 4.3.2.1)
argH
Argininosuccinate lyase (EC 4.3.2.1)

Position: -44
Score: 4.9
Sequence: CACTGCATAGGTATGCGTTC
Locus tag: SCO1086
Name: SCO1086
Funciton: Putative transglutaminase
SCO1086
Putative transglutaminase

Position: -57
Score: 4.5
Sequence: CATTGCATAAACGTGCATCG
Position: -37
Score: 4.1
Sequence: GCACGTATAGTCATGCTCTC
Locus tag: SCO1580
Name: argC
Funciton: N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
Locus tag: SCO1579
Name: argJ
Funciton: Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
Locus tag: SCO1578
Name: argB
Funciton: Acetylglutamate kinase (EC 2.7.2.8)
Locus tag: SCO1577
Name: argD
Funciton: Acetylornithine aminotransferase (EC 2.6.1.11)
Locus tag: SCO1576
Name: argR
Funciton: Arginine metabolism transcriptional regulator ArgR, ArgR family
argC
N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
argJ
Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
argB
Acetylglutamate kinase (EC 2.7.2.8)
argD
Acetylornithine aminotransferase (EC 2.6.1.11)
argR
Arginine metabolism transcriptional regulator ArgR, ArgR family

Position: -42
Score: 5.1
Sequence: TGTGGCATGATCATGCATTG
Locus tag: SCO2686
Name: SCO2628
Funciton: Predicted transcriptional regulator, LuxR family
SCO2628
Predicted transcriptional regulator, LuxR family

Position: -178
Score: 3.6
Sequence: CCACGCATGACCACTCAACA
Locus tag: SCO2015
Name: cpdB
Funciton: 2',3'-cyclic-nucleotide 2'-phosphodiesterase (EC 3.1.4.16)
cpdB
2',3'-cyclic-nucleotide 2'-phosphodiesterase (EC 3.1.4.16)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD