Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ArgR in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_6767
Regulator family: ArgR
Regulation mode: repressor (activator)
Biological process: Arginine biosynthesis
Effector: Arginine
Regulog: ArgR - Streptomycetaceae
Statistics of regulated genes:
- Genes 10
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 29 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -28
Score: 3.9
Sequence: CAGTGCAAGATCCTGCAGGA
Locus tag: SAV_3165
Name: SCO2628
Funciton: Predicted transcriptional regulator, LuxR family
SCO2628
Predicted transcriptional regulator, LuxR family

Position: -37
Score: 4.6
Sequence: CCTTGCATGAAAATGCGCGA
Locus tag: SAV_801
Name: argG
Funciton: Argininosuccinate synthase (EC 6.3.4.5)
argG
Argininosuccinate synthase (EC 6.3.4.5)

Position: -36
Score: 3.8
Sequence: TCATGCAGAGCCCTGCATAC
Position: -26
Score: 5.2
Sequence: CCCTGCATACTCATGCATGT
Locus tag: SAV_6778
Name: argG
Funciton: Argininosuccinate synthase (EC 6.3.4.5)
Locus tag: SAV_6779
Name: argH
Funciton: Argininosuccinate lyase (EC 4.3.2.1)
argG
Argininosuccinate synthase (EC 6.3.4.5)
argH
Argininosuccinate lyase (EC 4.3.2.1)

Position: -55
Score: 4.2
Sequence: GATTGCATAAACGTGCAGCG
Position: -35
Score: 4.6
Sequence: AAACGTATAGTCATGCCATC
Locus tag: SAV_6763
Name: argC
Funciton: N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
Locus tag: SAV_6764
Name: argJ
Funciton: Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
Locus tag: SAV_6765
Name: argB
Funciton: Acetylglutamate kinase (EC 2.7.2.8)
Locus tag: SAV_6766
Name: argD
Funciton: Acetylornithine aminotransferase (EC 2.6.1.11)
Locus tag: SAV_6767
Name: argR
Funciton: Arginine metabolism transcriptional regulator ArgR, ArgR family
argC
N-acetyl-gamma-glutamyl-phosphate reductase (EC 1.2.1.38)
argJ
Glutamate N-acetyltransferase (EC 2.3.1.35) / N-acetylglutamate synthase (EC 2.3.1.1)
argB
Acetylglutamate kinase (EC 2.7.2.8)
argD
Acetylornithine aminotransferase (EC 2.6.1.11)
argR
Arginine metabolism transcriptional regulator ArgR, ArgR family

Position: -44
Score: 4.6
Sequence: CGATGCATAGATATGCGATC
Locus tag: SAV_1487
Name: SCO1086
Funciton: Putative transglutaminase
SCO1086
Putative transglutaminase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD