Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LexA in Listeria seeligeri serovar 1/2b str. SLCC3954

Properties
Regulator type: Transcription factor
TF locus tag: lse_1219
Regulator family: LexA
Regulation mode: repressor
Biological process: SOS response
Effector: DNA damage
Regulog: LexA - Listeriaceae
Statistics of regulated genes:
- Genes 22
- Operons 10
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 48 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 5.5
Sequence: ATTAAGGAACATTTGTTCGTTTTT
Locus tag: lse_1955
Name: dinP
Funciton: DNA polymerase IV (EC 2.7.7.7)
dinP
DNA polymerase IV (EC 2.7.7.7)

Position: -165
Score: 6.4
Sequence: AAATACGAAAATATGTTCGGTTTT
Locus tag: lse_2389
Name: uvrB
Funciton: Excinuclease ABC, subunit B
Locus tag: lse_2388
Name: uvrA
Funciton: Excinuclease ABC, subunit A
uvrB
Excinuclease ABC, subunit B
uvrA
Excinuclease ABC, subunit A

Position: -44
Score: 5.8
Sequence: AAATAAGAACAAATGTTTGTATGG
Locus tag: lse_1731
Name: pcrA
Funciton: ATP-dependent DNA helicase UvrD/PcrA
Locus tag: lse_1730
Name: ligA
Funciton: DNA ligase (EC 6.5.1.2)
Locus tag: lse_1729
Name: yerH
Funciton: Putative lipoprotein
pcrA
ATP-dependent DNA helicase UvrD/PcrA
ligA
DNA ligase (EC 6.5.1.2)
yerH
Putative lipoprotein

Position: -30
Score: 5.6
Sequence: AAATAAAAACGTATGTTCGGTGGT
Locus tag: lse_2247
Name: addB
Funciton: ATP-dependent nuclease, subunit B
Locus tag: lse_2246
Name: addA
Funciton: ATP-dependent nuclease, subunit A
Locus tag: lse_2245
Name: yisK
Funciton: Conserved hypothetical protein
Locus tag: lse_2244
Name: PF07457
Funciton: Conserved hypothetical protein
addB
ATP-dependent nuclease, subunit B
addA
ATP-dependent nuclease, subunit A
yisK
Conserved hypothetical protein
PF07457
Conserved hypothetical protein

Position: -142
Score: 5.7
Sequence: CCAAAAGAATGTATGTTCGCTTTT
Position: -83
Score: 5.6
Sequence: AAAAACGAACCTTTGTTTGCATAT
Locus tag: lse_1219
Name: lexA
Funciton: SOS-response repressor and protease LexA (EC 3.4.21.88)
Locus tag: lse_1218
Name: guaA
Funciton: Probable GMP synthase
lexA
SOS-response repressor and protease LexA (EC 3.4.21.88)
guaA
Probable GMP synthase

Position: -143
Score: 6.3
Sequence: AAATACGAATAAATGTTCGCTTTT
Locus tag: lse_1315
Name: recA
Funciton: DNA recombinase A
recA
DNA recombinase A

Position: -75
Score: 5.8
Sequence: AAACACGAACACACTTTCTTTTTT
Locus tag: lse_1489
Name: dnaE
Funciton: DNA polymerase III alpha subunit (EC 2.7.7.7)
dnaE
DNA polymerase III alpha subunit (EC 2.7.7.7)

Position: -47
Score: 4.7
Sequence: AAAATAGAACGTATGTTTTATGAT
Locus tag: lse_1561
Name: lin1681
Funciton: Conserved hypothetical protein
Locus tag: lse_1560
Name: tag
Funciton: DNA-3-methyladenine glycosylase (EC 3.2.2.20)
Locus tag: lse_1559
Name: lin1679
Funciton: Putative carboxypeptidase
lin1681
Conserved hypothetical protein
tag
DNA-3-methyladenine glycosylase (EC 3.2.2.20)
lin1679
Putative carboxypeptidase

Position: -72
Score: 5.2
Sequence: CAACAAGAACATTCGTTCGTATAA
Locus tag: lse_2581
Name: lmo2675
Funciton: Conserved hypothetical protein
Locus tag: lse_2582
Name: uvrX
Funciton: Predicted UV-damage repair protein UvrX
lmo2675
Conserved hypothetical protein
uvrX
Predicted UV-damage repair protein UvrX

Position: -44
Score: 5.9
Sequence: TAATAAGAACGTATATTCGGTTTT
Locus tag: lse_2202
Name: yhaO
Funciton: Predicted DNA double-strand break repair protein
Locus tag: lse_2201
Name: yhaN
Funciton: Putative DNA double-strand break repair ATPase
Locus tag: lse_2200
Name: yhaM
Funciton: Predicted 3'-5' exoribonuclease
yhaO
Predicted DNA double-strand break repair protein
yhaN
Putative DNA double-strand break repair ATPase
yhaM
Predicted 3'-5' exoribonuclease
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD