Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of HrcA in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_61551
Regulator family: HrcA
Regulation mode: repressor
Biological process: Heat shock response
Effector: Heat shock
Regulog: HrcA - Streptomycetaceae
Statistics of regulated genes:
- Genes 6
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 24 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -189
Score: 6.8
Sequence: CTTGCACTCGCAGGGGGCGAGTGCTAA
Position: -153
Score: 6.7
Sequence: TTAGCACTCTGAAGGTGAGAGTGACAA
Locus tag: SCAB_50441
Name: groL2
Funciton: Heat shock protein 60 family chaperone GroEL
groL2
Heat shock protein 60 family chaperone GroEL

Position: -172
Score: 6.1
Sequence: TTAGCAGTCCGCTTGACCGAGTGCTAA
Position: -125
Score: 7.1
Sequence: CTGGCACTCCCCCCTGGAGAGTGCCAA
Locus tag: SCAB_36301
Name: groS
Funciton: Heat shock protein 60 family co-chaperone GroES
Locus tag: SCAB_36291
Name: groL
Funciton: Heat shock protein 60 family chaperone GroEL
groS
Heat shock protein 60 family co-chaperone GroES
groL
Heat shock protein 60 family chaperone GroEL

Position: -16
Score: 7.2
Sequence: TTGGCACTCGCCCGGGGTGAGTGCCAA
Locus tag: SCAB_61551
Name: hrcA
Funciton: Heat shock response transcriptional regulator HrcA, HrcA family
Locus tag: SCAB_61561
Name: dnaJ
Funciton: Chaperone protein DnaJ
hrcA
Heat shock response transcriptional regulator HrcA, HrcA family
dnaJ
Chaperone protein DnaJ

Position: -38
Score: 6.6
Sequence: TTAGCACTCATCGAGTGAGAGTGCCAG
Locus tag: SCAB_53081
Name: COG2331
Funciton: Conserved hypothetical protein
COG2331
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD