Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Methylobacillus flagellatus KT

Properties
Regulator type: Transcription factor
TF locus tag: Mfla_2293
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Regulog: ModE2 - Various betaproteobacteria
Statistics of regulated genes:
- Genes 5
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -79
Score: 6
Sequence: TGTAAGTCCTTCGGTCAATACTAACA
Locus tag: Mfla_2293
Name: modE2
Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
modE2
Molybdate-responsive transcriptional regulator ModE2, ModE family

Position: -48
Score: 6
Sequence: TGTTAGTATTGACCGAAGGACTTACA
Locus tag: Mfla_2294
Name: moaA
Funciton: Molybdenum cofactor biosynthesis protein MoaA
Locus tag: Mfla_2295
Name: mobA
Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobA
Locus tag: Mfla_2296
Name: mobB
Funciton: Molybdopterin-guanine dinucleotide biosynthesis protein MobB
Locus tag: Mfla_2297
Name: moeA
Funciton: Molybdopterin biosynthesis protein MoeA
moaA
Molybdenum cofactor biosynthesis protein MoaA
mobA
Molybdopterin-guanine dinucleotide biosynthesis protein MobA
mobB
Molybdopterin-guanine dinucleotide biosynthesis protein MobB
moeA
Molybdopterin biosynthesis protein MoeA
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD