Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Verminephrobacter eiseniae EF01-2

Properties
Regulator type: Transcription factor
TF locus tag: Veis_3515
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Regulog: ModE2 - Comamonadaceae
Statistics of regulated genes:
- Genes 1
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -212
Score: 6
Sequence: TACGTCGTATTCCATCGGATATGTCAAA
Locus tag: Veis_3515
Name: modE2
Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
modE2
Molybdate-responsive transcriptional regulator ModE2, ModE family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD