Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Polaromonas sp. JS666

Properties
Regulator type: Transcription factor
TF locus tag: Bpro_2496
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Regulog: ModE2 - Comamonadaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -103
Score: 6.9
Sequence: TTCGCTATATTTAATGGAATATAGCGAA
Locus tag: Bpro_2496
Name: modE2
Funciton: Molybdate-responsive transcriptional regulator ModE2, ModE family
modE2
Molybdate-responsive transcriptional regulator ModE2, ModE family

Position: -99
Score: 6.9
Sequence: TTCGCTATATTCCATTAAATATAGCGAA
Locus tag: Bpro_2497
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: Bpro_2498
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Bpro_2499
Name: modC
Funciton: Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
modA
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modC
Molybdenum transport ATP-binding protein ModC (TC 3.A.1.8.1)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD