Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE2 in Comamonas testosteroni KF-1

Properties
Regulator type: Transcription factor
TF locus tag: CtesDRAFT_0896
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Molybdopterin biosynthesis
Effector: Molybdate
Regulog: ModE2 - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -68
Score: 5.9
Sequence: AGTGTTATATTCCGTCAAATATAACGTG
Locus tag: CtesDRAFT_0892
Name: modA
Funciton: Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
Locus tag: CtesDRAFT_0893
Name: modB
Funciton: Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)
modA
Molybdenum ABC transporter, periplasmic molybdenum-binding protein ModA (TC 3.A.1.8.1)
modB
Molybdenum transport system permease protein ModB (TC 3.A.1.8.1)

Position: -50
Score: 5.9
Sequence: CACGTTATATTTGACGGAATATAACACT
Locus tag: CtesDRAFT_0891
Name: COG1720
Funciton: Conserved hypothetical protein
COG1720
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD