Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE3 in Variovorax paradoxus S110

Properties
Regulator type: Transcription factor
TF locus tag: Vapar_1577
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Regulog: ModE3 - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -74
Score: 6.1
Sequence: CTATGCAAAATCCTGCATAG
Locus tag: Vapar_1588
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Vapar_1589
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Vapar_1590
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA
Tungstate ABC-type transporter, permease protein
tupC
Tungstate ABC-type transporter, ATP-binding protein
tupB
Tungstate ABC-type transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD