Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE3 in Polaromonas sp. JS666

Properties
Regulator type: Transcription factor
TF locus tag: Bpro_1757
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Regulog: ModE3 - Comamonadaceae
Statistics of regulated genes:
- Genes 10
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -85
Score: 5.8
Sequence: CTATGCAAACCCATTCATAA
Locus tag: Bpro_1758
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Bpro_1759
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Bpro_1760
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA
Tungstate ABC-type transporter, permease protein
tupC
Tungstate ABC-type transporter, ATP-binding protein
tupB
Tungstate ABC-type transporter, substrate-binding protein

Position: -48
Score: 5.8
Sequence: GTATGCAAACCGTTGCATAC
Locus tag: Bpro_0936
Name: fdoX
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpro_0937
Name: fdoG
Funciton: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
Locus tag: Bpro_0938
Name: fdoH
Funciton: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
Locus tag: Bpro_0939
Name: fdoY
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpro_0940
Name: fdoI
Funciton: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
Locus tag: Bpro_0941
Name: fdoZ
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Bpro_0942
Name: fdhD
Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
fdoX
Putative subunit of formate dehydrogenase
fdoG
Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
fdoH
Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
fdoY
Putative subunit of formate dehydrogenase
fdoI
Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
fdoZ
Putative subunit of formate dehydrogenase
fdhD
Formate dehydrogenase chain D (EC 1.2.1.2)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD