Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE3 in Leptothrix cholodnii SP-6

Properties
Regulator type: Transcription factor
TF locus tag: Lcho_1822
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Regulog: ModE3 - Comamonadaceae
Statistics of regulated genes:
- Genes 12
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -39
Score: 5.5
Sequence: ATATGCAGGCCTTTGCATGG
Locus tag: Lcho_3729
Name: fdoX
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Lcho_3728
Name: fdoG
Funciton: Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
Locus tag: Lcho_3727
Name: fdoH
Funciton: Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
Locus tag: Lcho_3726
Name: fdoY
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Lcho_3725
Name: fdoI
Funciton: Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
Locus tag: Lcho_3724
Name: fdoZ
Funciton: Putative subunit of formate dehydrogenase
Locus tag: Lcho_3723
Name: fdhD
Funciton: Formate dehydrogenase chain D (EC 1.2.1.2)
fdoX
Putative subunit of formate dehydrogenase
fdoG
Formate dehydrogenase-O, major subunit (EC 1.2.1.2)
fdoH
Formate dehydrogenase-O, iron-sulfur subunit (EC 1.2.1.2)
fdoY
Putative subunit of formate dehydrogenase
fdoI
Formate dehydrogenase-O, gamma subunit (EC 1.2.1.2)
fdoZ
Putative subunit of formate dehydrogenase
fdhD
Formate dehydrogenase chain D (EC 1.2.1.2)

Position: -91
Score: 6.2
Sequence: CTATGCAGATGATTGCATAG
Locus tag: Lcho_1816
Name: Ajs_3943
Funciton: NADH-dependent dehydrogenase, iron-sulfur binding protein
Locus tag: Lcho_1817
Name: Ajs_3944
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase
Locus tag: Lcho_1818
Name: Ajs_3945
Funciton: NADH-dependent dehydrogenase, NADH-binding subunit
Locus tag: Lcho_1819
Name: Ajs_3946
Funciton: Conserved hypothetical protein
Locus tag: Lcho_1820
Name: Ajs_3947
Funciton: Conserved hypothetical protein
Ajs_3943
NADH-dependent dehydrogenase, iron-sulfur binding protein
Ajs_3944
Tungsten-containing aldehyde ferredoxin oxidoreductase
Ajs_3945
NADH-dependent dehydrogenase, NADH-binding subunit
Ajs_3946
Conserved hypothetical protein
Ajs_3947
Conserved hypothetical protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD