Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of ModE3 in Acidovorax sp. JS42

Properties
Regulator type: Transcription factor
TF locus tag: Ajs_3130
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Tungsten homeostasis
Effector: Tungsten
Regulog: ModE3 - Comamonadaceae
Statistics of regulated genes:
- Genes 8
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -65
Score: 6.4
Sequence: CTATGCAAATCTTTTCATAG
Locus tag: Ajs_3943
Name: Ajs_3943
Funciton: NADH-dependent dehydrogenase, iron-sulfur binding protein
Locus tag: Ajs_3944
Name: Ajs_3944
Funciton: Tungsten-containing aldehyde ferredoxin oxidoreductase
Locus tag: Ajs_3945
Name: Ajs_3945
Funciton: NADH-dependent dehydrogenase, NADH-binding subunit
Locus tag: Ajs_3946
Name: Ajs_3946
Funciton: Conserved hypothetical protein
Locus tag: Ajs_3947
Name: Ajs_3947
Funciton: Conserved hypothetical protein
Ajs_3943
NADH-dependent dehydrogenase, iron-sulfur binding protein
Ajs_3944
Tungsten-containing aldehyde ferredoxin oxidoreductase
Ajs_3945
NADH-dependent dehydrogenase, NADH-binding subunit
Ajs_3946
Conserved hypothetical protein
Ajs_3947
Conserved hypothetical protein

Position: -58
Score: 5.9
Sequence: CTATGCACAAGTTTTCATAT
Locus tag: Ajs_3129
Name: tupA
Funciton: Tungstate ABC-type transporter, permease protein
Locus tag: Ajs_3128
Name: tupC
Funciton: Tungstate ABC-type transporter, ATP-binding protein
Locus tag: Ajs_3127
Name: tupB
Funciton: Tungstate ABC-type transporter, substrate-binding protein
tupA
Tungstate ABC-type transporter, permease protein
tupC
Tungstate ABC-type transporter, ATP-binding protein
tupB
Tungstate ABC-type transporter, substrate-binding protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD