Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FdsR in Variovorax paradoxus S110

Properties
Regulator type: Transcription factor
TF locus tag: Vapar_3016
Regulator family: ModE
Regulation mode: repressor (activator)
Biological process: Formate oxydation
Effector: Formate
Regulog: FdsR - Comamonadaceae
Statistics of regulated genes:
- Genes 6
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 4 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -119
Score: 5.8
Sequence: TTCGGCTTTCCAAAGCATAT
Locus tag: Vapar_3017
Name: fdsG
Funciton: NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
Locus tag: Vapar_3018
Name: fdsB
Funciton: NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
Locus tag: Vapar_3019
Name: fdsA
Funciton: NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
Locus tag: Vapar_3020
Name: fdsC
Funciton: NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
Locus tag: Vapar_3021
Name: fdsD
Funciton: NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit
fdsG
NAD-dependent formate dehydrogenase (EC 1.2.1.2), gamma subunit
fdsB
NAD-dependent formate dehydrogenase (EC 1.2.1.2), beta subunit
fdsA
NAD-dependent formate dehydrogenase (EC 1.2.1.2), alpha subunit
fdsC
NAD-dependent formate dehydrogenase (EC 1.2.1.2), accessory protein
fdsD
NAD-dependent formate dehydrogenase (EC 1.2.1.2), delta subunit

Position: -24
Score: 5.8
Sequence: ATATGCTTTGGAAAGCCGAA
Locus tag: Vapar_3016
Name: fdsR
Funciton: Formate dehydrogenase transcriptional regulator FdsR, ModE family
fdsR
Formate dehydrogenase transcriptional regulator FdsR, ModE family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD