Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_71891, SCAB_24481
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Streptomycetaceae
Statistics of regulated genes:
- Genes 7
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -92
Score: 4.7
Sequence: ATCTCGTCCCCTTGACGATAA
Position: -59
Score: 5.5
Sequence: TTATCGTCTGAGTGACACTAA
Locus tag: SCAB_23161
Name: orfX
Funciton: NrtR-regulated hypothetical OrfX
Locus tag: SCAB_23171
Name: orfY
Funciton: NrtR-regulated hypothetical OrfY
orfX
NrtR-regulated hypothetical OrfX
orfY
NrtR-regulated hypothetical OrfY

Position: -52
Score: 6.2
Sequence: TTATAGTCGTTCTGACTATTA
Position: -36
Score: 5.5
Sequence: TATTAGTCATGGTGACCATAA
Locus tag: SCAB_71891
Name: nrtR1
Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: SCAB_71901
Name: draG
Funciton: NrtR-regulated ADP-ribosyl-glycohydrolase DraG
Locus tag: SCAB_71911
Name: PF10127
Funciton: Nucleotidyltransferase, predicted
nrtR1
Nudix-related transcriptional regulator NrtR
draG
NrtR-regulated ADP-ribosyl-glycohydrolase DraG
PF10127
Nucleotidyltransferase, predicted

Position: -31
Score: 4.9
Sequence: TTATCGTCAGGCAGACGACTA
Locus tag: SCAB_24481
Name: nrtR2
Funciton: Nudix-related transcriptional regulator NrtR
nrtR2
Nudix-related transcriptional regulator NrtR

Position: -31
Score: 5
Sequence: ATAATGTCGCTCTGACGATTA
Locus tag: SCAB_66451
Name: nadE
Funciton: NAD synthetase (EC 6.3.1.5)
nadE
NAD synthetase (EC 6.3.1.5)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD