Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type: Transcription factor
TF locus tag: SGR_5732, SGR_1704
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Streptomycetaceae
Statistics of regulated genes:
- Genes 8
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -70
Score: 6
Sequence: TAATAGTCACCTTGACTCTAA
Position: -37
Score: 4.8
Sequence: TTATCGTCGCCATGACGAAAT
Locus tag: SGR_831
Name: orfX
Funciton: NrtR-regulated hypothetical OrfX
Locus tag: SGR_832
Name: orfY
Funciton: NrtR-regulated hypothetical OrfY
orfX
NrtR-regulated hypothetical OrfX
orfY
NrtR-regulated hypothetical OrfY

Position: -11
Score: 6.4
Sequence: TTATAGTCAGAGTGACTATTA
Locus tag: SGR_5730
Name: pnuC
Funciton: Ribosyl nicotinamide transporter, PnuC family
Locus tag: SGR_5731
Name: nadR
Funciton: Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
Locus tag: SGR_5732
Name: nrtR1
Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: SGR_5733
Name: draG
Funciton: NrtR-regulated ADP-ribosyl-glycohydrolase DraG
pnuC
Ribosyl nicotinamide transporter, PnuC family
nadR
Nicotinamide-nucleotide adenylyltransferase, NadR family (EC 2.7.7.1) / Ribosylnicotinamide kinase (EC 2.7.1.22)
nrtR1
Nudix-related transcriptional regulator NrtR
draG
NrtR-regulated ADP-ribosyl-glycohydrolase DraG

Position: -31
Score: 4.9
Sequence: TTATCGTCAGGCAGACGACTA
Locus tag: SGR_1704
Name: nrtR2
Funciton: Nudix-related transcriptional regulator NrtR
nrtR2
Nudix-related transcriptional regulator NrtR

Position: -32
Score: 4.4
Sequence: ATCGCGTCAGAAAGACGATTA
Locus tag: SGR_5258
Name: nadE
Funciton: NAD synthetase (EC 6.3.1.5)
nadE
NAD synthetase (EC 6.3.1.5)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD