Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of NrtR in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO1767, SCO5817
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Regulog: NrtR - Streptomycetaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 19 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -36
Score: 6.4
Sequence: TTATAGTCGCAGTGACTATTA
Locus tag: SCO1767
Name: nrtR1
Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: SCO1766
Name: draG
Funciton: NrtR-regulated ADP-ribosyl-glycohydrolase DraG
Locus tag: SCO1765
Name: PF10127
Funciton: Nucleotidyltransferase, predicted
nrtR1
Nudix-related transcriptional regulator NrtR
draG
NrtR-regulated ADP-ribosyl-glycohydrolase DraG
PF10127
Nucleotidyltransferase, predicted

Position: 41
Score: 4.4
Sequence: ATTGCGTCGTTCTGACGATTA
Locus tag: SCO2238
Name: nadE
Funciton: NAD synthetase (EC 6.3.1.5)
nadE
NAD synthetase (EC 6.3.1.5)
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD