Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PhnR1 in Aeromonas hydrophila subsp. hydrophila ATCC 7966

Properties
Regulator type: Transcription factor
TF locus tag: AHA_3982
Regulator family: GntR/Others
Regulation mode:
Biological process: 2-aminoethylphosphonate utilization
Effector: 2-aminoethylphosphonate
Regulog: PhnR1 - Psychromonadaceae/Aeromonadales
Statistics of regulated genes:
- Genes 7
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -294
Score: 5.9
Sequence: TTGCTGGAGTAGTCCAGCTT
Position: -152
Score: 5.6
Sequence: TAACTGACCTAGTCCAGAGG
Locus tag: AHA_3983
Name: phnS
Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
Locus tag: AHA_3984
Name: AHA_3984
Funciton: type I phosphodiesterase
Locus tag: AHA_3985
Name: phnU
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
Locus tag: AHA_3986
Name: phnV
Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
Locus tag: AHA_3987
Name: phnT
Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
Locus tag: AHA_3988
Name: COG0560
Funciton: Phosphoserine phosphatase (EC 3.1.3.3)
phnS
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
AHA_3984
type I phosphodiesterase
phnU
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
phnV
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
phnT
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
COG0560
Phosphoserine phosphatase (EC 3.1.3.3)

Position: -218
Score: 5.6
Sequence: CCTCTGGACTAGGTCAGTTA
Position: -76
Score: 5.9
Sequence: AAGCTGGACTACTCCAGCAA
Locus tag: AHA_3982
Name: null
Funciton: 2-aminoethylphosphonate uptake and metabolism regulator, GntR family
2-aminoethylphosphonate uptake and metabolism regulator, GntR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD