Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LndYR in Streptomyces griseus subsp. griseus NBRC 13350

Properties
Regulator type: Transcription factor
TF locus tag: SGR_2538, SGR_3939, SGR_3238
Regulator family: GntR/Others
Regulation mode:
Biological process: Antibiotic resistance
Effector:
Regulog: LndYR - Streptomycetaceae
Statistics of regulated genes:
- Genes 9
- Operons 3
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -28
Score: 5.7
Sequence: ATTCCATTAATTGACTAATGGAAT
Locus tag: SGR_3236
Name: lndWA
Funciton: Landomycin ABC transporter, ATP-binding protein
Locus tag: SGR_3237
Name: lndWP
Funciton: Landomycin ABC transporter, permease protein
Locus tag: SGR_3238
Name: lndYR
Funciton: Transcriptional regulator of landomycin production, GntR family
lndWA
Landomycin ABC transporter, ATP-binding protein
lndWP
Landomycin ABC transporter, permease protein
lndYR
Transcriptional regulator of landomycin production, GntR family

Position: -22
Score: 4.6
Sequence: ATAGTGCTAGGCAACTAGATAAAT
Locus tag: SGR_2538
Name: null
Funciton: putative GntR-family transcriptional regulator
Locus tag: SGR_2537
Name: null
Funciton: putative ABC transporter ATP-binding protein
Locus tag: SGR_2536
Name: null
Funciton: putative transmembrane transport protein
putative GntR-family transcriptional regulator
putative ABC transporter ATP-binding protein
putative transmembrane transport protein

Position: -25
Score: 5.9
Sequence: CTTTCACTACTCAATTAGTGAAAG
Locus tag: SGR_3939
Name: lndYR
Funciton: Transcriptional regulator of landomycin production, GntR family
Locus tag: SGR_3938
Name: lndWA
Funciton: Landomycin ABC transporter, ATP-binding protein
Locus tag: SGR_3937
Name: lndWP
Funciton: Landomycin ABC transporter, permease protein
lndYR
Transcriptional regulator of landomycin production, GntR family
lndWA
Landomycin ABC transporter, ATP-binding protein
lndWP
Landomycin ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD