Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of LndYR in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_4065
Regulator family: GntR/Others
Regulation mode:
Biological process: Antibiotic resistance
Effector:
Regulog: LndYR - Streptomycetaceae
Statistics of regulated genes:
- Genes 4
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 7 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -25
Score: 5.9
Sequence: CTTTCACTACTCAATTAGTGAAAG
Locus tag: SAV_4065
Name: lndYR
Funciton: Transcriptional regulator of landomycin production, GntR family
Locus tag: SAV_4066
Name: lndWA
Funciton: Landomycin ABC transporter, ATP-binding protein
Locus tag: SAV_4067
Name: lndWP
Funciton: Landomycin ABC transporter, permease protein
Locus tag: SAV_4068
Name: lndWP
Funciton: Landomycin ABC transporter, permease protein
lndYR
Transcriptional regulator of landomycin production, GntR family
lndWA
Landomycin ABC transporter, ATP-binding protein
lndWP
Landomycin ABC transporter, permease protein
lndWP
Landomycin ABC transporter, permease protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD