Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdxR3 in Streptomyces scabiei 87.22

Properties
Regulator type: Transcription factor
TF locus tag: SCAB_75881
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Streptomycetaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -30
Score: 5.3
Sequence: TGGCCAATTCGGGGAAGGTGGACT
Locus tag: SCAB_75881
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3
Transcriptional regulator, GntR/MocR family

Position: -92
Score: 5.3
Sequence: AGTCCACCTTCCCCGAATTGGCCA
Locus tag: SCAB_75871
Name: COG2364
Funciton: Predicted membrane protein
Locus tag: SCAB_75861
Name: COG0584
Funciton: Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
Locus tag: SCAB_75851
Name: COG2270
Funciton: Permeases of the major facilitator superfamily
COG2364
Predicted membrane protein
COG0584
Glycerophosphoryl diester phosphodiesterase (EC 3.1.4.46)
COG2270
Permeases of the major facilitator superfamily
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD