Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of PdxR3 in Streptomyces avermitilis MA-4680

Properties
Regulator type: Transcription factor
TF locus tag: SAV_980, SAV_6928
Regulator family: GntR/MocR
Regulation mode:
Biological process: Pyridoxine/pyridoxal homeostasis
Effector:
Regulog: PdxR3 - Streptomycetaceae
Statistics of regulated genes:
- Genes 4
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 12 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -129
Score: 3.8
Sequence: GAACCAGCCTAGCCAATCTGGCTA
Locus tag: SAV_7578
Name: COG2364
Funciton: Predicted membrane protein
COG2364
Predicted membrane protein

Position: -25
Score: 3.8
Sequence: TAGCCAGATTGGCTAGGCTGGTTC
Locus tag: SAV_980
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3
Transcriptional regulator, GntR/MocR family

Position: -31
Score: 5.5
Sequence: TGGCCAATTCCGGGAAGGTGGACT
Locus tag: SAV_6928
Name: pdxR3
Funciton: Transcriptional regulator, GntR/MocR family
pdxR3
Transcriptional regulator, GntR/MocR family

Position: 9
Score: 5.5
Sequence: AGTCCACCTTCCCGGAATTGGCCA
Locus tag: SAV_6929
Name: COG2364
Funciton: Predicted membrane protein
COG2364
Predicted membrane protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD