Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of SCO3812 in Streptomyces coelicolor A3(2)

Properties
Regulator type: Transcription factor
TF locus tag: SCO3812
Regulator family: GntR/Others
Regulation mode:
Biological process: Multidrug efflux
Effector:
Regulog: SCO3812 - Streptomycetaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -22
Score: 5.5
Sequence: TGGTGATAGTTTCATTAGCACCA
Locus tag: SCO3812
Name: SCO3812
Funciton: Transcriptional regulator, GntR family
Locus tag: SCO3813
Name: SCO3813
Funciton: putative membrane protein
SCO3812
Transcriptional regulator, GntR family
SCO3813
putative membrane protein
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD