Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of FruR2 in Acidovorax avenae subsp. citrulli AAC00-1

Properties
Regulator type: Transcription factor
TF locus tag: Aave_4253
Regulator family: LacI
Regulation mode: repressor
Biological process: Fructose utilization
Effector: Fructose-1-phosphate
Regulog: FruR2 - Comamonadaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 8 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -225
Score: 4
Sequence: GCATGGTAACGATTCCATGA
Position: -35
Score: 4.3
Sequence: GTCTGGAATCGATACCAAAT
Locus tag: Aave_4252
Name: fruB
Funciton: PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
Locus tag: Aave_4251
Name: fruK
Funciton: 1-phosphofructokinase (EC 2.7.1.56)
Locus tag: Aave_4250
Name: fruA
Funciton: PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)
fruB
PTS system, fructose-specific IIA component (EC 2.7.1.69) / Phosphotransferase system, phosphocarrier protein HPr / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)
fruK
1-phosphofructokinase (EC 2.7.1.56)
fruA
PTS system, fructose-specific IIB component (EC 2.7.1.69) / PTS system, fructose-specific IIC component (EC 2.7.1.69)

Position: -206
Score: 4.3
Sequence: ATTTGGTATCGATTCCAGAC
Position: -16
Score: 4
Sequence: TCATGGAATCGTTACCATGC
Locus tag: Aave_4253
Name: fruR2
Funciton: Transcriptional regulator for fructose utilization, LacI family
fruR2
Transcriptional regulator for fructose utilization, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD