Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Bpro_5109 in Verminephrobacter eiseniae EF01-2

Properties
Regulator type: Transcription factor
TF locus tag: Veis_4515
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Bpro_5109 - Comamonadaceae
Statistics of regulated genes:
- Genes 9
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -34
Score: 5.8
Sequence: AAATGACTACGAATACATTT
Locus tag: Veis_4515
Name: Bpro_5109
Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Veis_4516
Name: Veis_4516
Funciton: Predicted sugar ABC transporter, substrate-binding protein
Locus tag: Veis_4517
Name: Veis_4517
Funciton: Predicted sugar ABC transporter, permease protein 1
Locus tag: Veis_4518
Name: Veis_4518
Funciton: Predicted sugar ABC transporter, permease protein 2
Locus tag: Veis_4519
Name: Veis_4519
Funciton: Predicted oxidoreductase
Locus tag: Veis_4520
Name: Veis_4520
Funciton: Predicted dehydrogenase
Locus tag: Veis_4521
Name: Veis_4521
Funciton: Predicted sugar ABC transporter, ATP-binding protein
Locus tag: Veis_4522
Name: Veis_4522
Funciton: Putative membrane protein
Locus tag: Veis_4523
Name: Veis_4523
Funciton: Putative dehydratase
Bpro_5109
Predicted transcriptional regulator, LacI family
Veis_4516
Predicted sugar ABC transporter, substrate-binding protein
Veis_4517
Predicted sugar ABC transporter, permease protein 1
Veis_4518
Predicted sugar ABC transporter, permease protein 2
Veis_4519
Predicted oxidoreductase
Veis_4520
Predicted dehydrogenase
Veis_4521
Predicted sugar ABC transporter, ATP-binding protein
Veis_4522
Putative membrane protein
Veis_4523
Putative dehydratase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD