Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of Bpro_5109 in Polaromonas sp. JS666

Properties
Regulator type: Transcription factor
TF locus tag: Bpro_5109
Regulator family: LacI
Regulation mode: repressor
Biological process: Sugar utilization
Effector:
Regulog: Bpro_5109 - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 3 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -80
Score: 5.7
Sequence: ACGTGAATACGTATTCACAG
Position: -26
Score: 6
Sequence: TTATGACTACGTATTCAAAA
Locus tag: Bpro_5109
Name: Bpro_5109
Funciton: Predicted transcriptional regulator, LacI family
Locus tag: Bpro_5110
Name: Veis_4522
Funciton: Putative membrane protein
Locus tag: Bpro_5111
Name: Veis_4523
Funciton: Putative dehydratase
Bpro_5109
Predicted transcriptional regulator, LacI family
Veis_4522
Putative membrane protein
Veis_4523
Putative dehydratase
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD