Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of IscR in Shewanella baltica OS155

Properties
Regulator type: Transcription factor
TF locus tag: Sbal_2398
Regulator family: Rrf2
Regulation mode: repressor
Biological process: Iron-sulfur cluster biogenesis
Effector: Iron-sulfur cluster redox state
Regulog: IscR - Shewanellaceae
Statistics of regulated genes:
- Genes 11
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 93 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -46
Score: 5
Sequence: AATTCTTACTAAAACACTCAGGTAT
Locus tag: Sbal_0142
Name: nfuA
Funciton: NfuA Fe-S protein maturation
nfuA
NfuA Fe-S protein maturation

Position: -64
Score: 5.7
Sequence: ATACTTGAACAAAACAGTCAGGTAA
Locus tag: Sbal_1163
Name: erpA
Funciton: ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family
erpA
ErpA, essential respiratory protein A / probable iron binding protein from the HesB_IscA_SufA family

Position: -29
Score: 4.5
Sequence: ATATCCGAGTGACAAGCTAAGGTAT
Locus tag: Sbal_4067
Name: ygbA
Funciton: hypothetical protein involved in nitrosative stress
ygbA
hypothetical protein involved in nitrosative stress

Position: -89
Score: 5.2
Sequence: AATCCTGAGTATTTTAGTCGGGTTT
Locus tag: Sbal_3989
Name: dnrN
Funciton: Nitric oxide-dependent regulator DnrN or NorA
dnrN
Nitric oxide-dependent regulator DnrN or NorA

Position: -90
Score: 5.4
Sequence: ATACTTGAGTGTTTTAGTAGGTTTT
Position: -64
Score: 6.4
Sequence: ATACTTGACTGATTTACTCGGGTAT
Locus tag: Sbal_2398
Name: iscR
Funciton: Iron-sulfur cluster regulator IscR
Locus tag: Sbal_2397
Name: iscS
Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
Locus tag: Sbal_2396
Name: iscU
Funciton: Iron-sulfur cluster assembly scaffold protein IscU
Locus tag: Sbal_2395
Name: iscA
Funciton: Iron binding protein IscA for iron-sulfur cluster assembly
Locus tag: Sbal_2394
Name: hscB
Funciton: Chaperone protein HscB
Locus tag: Sbal_2393
Name: hscA
Funciton: Chaperone protein HscA
Locus tag: Sbal_2392
Name: fdx
Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR
Iron-sulfur cluster regulator IscR
iscS
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily
iscU
Iron-sulfur cluster assembly scaffold protein IscU
iscA
Iron binding protein IscA for iron-sulfur cluster assembly
hscB
Chaperone protein HscB
hscA
Chaperone protein HscA
fdx
ferredoxin, 2Fe-2S type, ISC system
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD