Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CueR in Polaromonas sp. JS666

Properties
Regulator type: Transcription factor
TF locus tag: Bpro_4873, Bpro_3495
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Comamonadaceae
Statistics of regulated genes:
- Genes 6
- Operons 4
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -72
Score: 5.4
Sequence: ACTTTCCAACAGTGGCAAGGT
Locus tag: Bpro_3496
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Bpro_3495
Name: cueR2
Funciton: Copper-responsive transcriptional regulator, MerR family
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR2
Copper-responsive transcriptional regulator, MerR family

Position: -26
Score: 5
Sequence: ACCTTCCCACAGTCGGAAGCA
Locus tag: Bpro_3497
Name: copZ2
Funciton: Copper chaperone
copZ2
Copper chaperone

Position: -84
Score: 5.7
Sequence: ACCCTGCCATGATGGTAAGGT
Locus tag: Bpro_4872
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Bpro_4873
Name: cueR2
Funciton: Copper-responsive transcriptional regulator, MerR family
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR2
Copper-responsive transcriptional regulator, MerR family

Position: -218
Score: 5.6
Sequence: ACCCTGCCCCCGTGGGAAGGT
Locus tag: Bpro_4871
Name: copZ2
Funciton: Copper chaperone
copZ2
Copper chaperone
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD