Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CueR in Polaromonas naphthalenivorans CJ2

Properties
Regulator type: Transcription factor
TF locus tag: Pnap_4091
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Comamonadaceae
Statistics of regulated genes:
- Genes 3
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -82
Score: 5.7
Sequence: ACCCTGCCATGATGGCAAGGT
Locus tag: Pnap_4090
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Pnap_4091
Name: cueR2
Funciton: Copper-responsive transcriptional regulator, MerR family
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR2
Copper-responsive transcriptional regulator, MerR family

Position: -67
Score: 5.5
Sequence: ACTTTGCCACCGTGGGAAGGT
Locus tag: Pnap_4089
Name: copZ2
Funciton: Copper chaperone
copZ2
Copper chaperone
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD