Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CueR in Methylibium petroleiphilum PM1

Properties
Regulator type: Transcription factor
TF locus tag: Mpe_A3534, Mpe_A1639
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Comamonadaceae
Statistics of regulated genes:
- Genes 8
- Operons 5
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -59
Score: 4.8
Sequence: ACCTTGCCATCGTTAGAACCT
Locus tag: Mpe_A1640
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Mpe_A1639
Name: cueR2
Funciton: Copper-responsive transcriptional regulator, MerR family
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR2
Copper-responsive transcriptional regulator, MerR family

Position: -81
Score: 5.3
Sequence: ACCTTCCCACGTTGTCAAGGT
Locus tag: Mpe_A1644
Name: null
Funciton: hypothetical protein
Locus tag: Mpe_A1645
Name: copA3
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
hypothetical protein
copA3
Copper-translocating P-type ATPase (EC 3.6.3.4)

Position: -61
Score: 5.5
Sequence: ACCTTCCCACCGGGGCAACGT
Locus tag: Mpe_A3536
Name: copZ2
Funciton: Copper chaperone
copZ2
Copper chaperone

Position: -57
Score: 5.2
Sequence: ACCTTCCAACAGTAGGAGGGT
Locus tag: Mpe_A1641
Name: copZ2
Funciton: Copper chaperone
copZ2
Copper chaperone

Position: -34
Score: 5.7
Sequence: ACTTTGCCATGATGGGAAGGT
Locus tag: Mpe_A3535
Name: copA
Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
Locus tag: Mpe_A3534
Name: cueR2
Funciton: Copper-responsive transcriptional regulator, MerR family
copA
Copper-translocating P-type ATPase (EC 3.6.3.4)
cueR2
Copper-responsive transcriptional regulator, MerR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD