Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of CueR in Comamonas testosteroni KF-1

Properties
Regulator type: Transcription factor
TF locus tag: CtesDRAFT_3914
Regulator family: MerR
Regulation mode: activator (repressor)
Biological process: Copper resistance
Effector: Copper ion, (Cu+)
Regulog: CueR - Comamonadaceae
Statistics of regulated genes:
- Genes 2
- Operons 1
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 25 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -80
Score: 4.9
Sequence: ACCTTGTCATGATGTTAGGGT
Locus tag: CtesDRAFT_3915
Name: copZ
Funciton: Copper chaperone
Locus tag: CtesDRAFT_3914
Name: cueR
Funciton: Copper resistance ranscriptional regulator, MerR family
copZ
Copper chaperone
cueR
Copper resistance ranscriptional regulator, MerR family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD