Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 4.0 --

Regulon of GalR in Shewanella woodyi ATCC 51908

Properties
Regulator type: Transcription factor
TF locus tag: Swoo_2083
Regulator family: LacI
Regulation mode: repressor
Biological process: Galactose utilization
Effector: Galactose
Regulog: GalR - Shewanellaceae
Statistics of regulated genes:
- Genes 4
- Operons 2
Visualization:
Allows to visualize regulon content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Regulated operons
Locus Tag Name Function

Position: -51
Score: 5.8
Sequence: AAATGGAAACGTTTACATTT
Locus tag: Swoo_2084
Name: galT2
Funciton: Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
Locus tag: Swoo_2085
Name: galK2
Funciton: Galactokinase (EC 2.7.1.6)
Locus tag: Swoo_2086
Name: galP2
Funciton: Predicted sodium-dependent galactose transporter
galT2
Galactose-1-phosphate uridylyltransferase (EC 2.7.7.10)
galK2
Galactokinase (EC 2.7.1.6)
galP2
Predicted sodium-dependent galactose transporter

Position: -18
Score: 4.9
Sequence: TAATGTAAACGTTATCTTAT
Locus tag: Swoo_2083
Name: galR
Funciton: galactose utilization repressor, LacI family
galR
galactose utilization repressor, LacI family
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD